Part:BBa_K2991018

OptipBad CFP reporter

Description:

This allows you to study Opti-pBad BBa_K2991004 (optimized promoter BBa_I13453) with CFP.

What you can do with it:

In E.coli sugars are ranked depending on their capacity to increase growth rate. Promoters associated with each sugar operon will follow this hierarchy. Each part of the collection is made to exploit this Hierarchy (check our wiki,https://2019.igem.org/Team:Nantes).
You will learn more about it in this study ‘’G. Aidelberg, B. D. Towbin, D. Rothschild, E. Dekel, A. Bren, and U. Alon, “Hierarchy of non-glucose sugars in Escherichia coli,” BMC Syst. Biol., vol. 8, p. 133, 2014.’’

Compatibility:

Organism: We only tested this part in E.coli TOP10.
Backbone: We used the IDT plasmid with ampicillin resistance.

See more results on our wiki page.

The optimisation of pARA

One of our goals was to improve a part present in the iGEM “part registry”. In doing so, we wanted to continue working on sugar activated promoters. Therefore we chose 2 different promoters associated with the consumption of arabinose.

• part:BBA I13453 → that we call “1” from this point
• part:BBA K206000 → that we will call “3” from this point

We ordered these parts associated with a CFP reporter gene, as well as a second version of these parts with the consensus sequence of CRP (AAATGTGATCTAGATCACATT). .
After transforming top10 E.coli we obtained 4 different strains to be tested :

• “1” : pIDT pARAI13453 - CFP
• “2” : pIDT pARAI13453 optimized - CFP
• “3” : pIDT pARAK206000 - CFP
• “4” : pIDT pARAK206000 optimized -CFP
• “5” : pIDT pARAI13453 - GFP
• “6” : pIDT pARAI13453 optimized - GFP

We then cultivated our bacteria in M9 medium with 0.2% arabinose. Our 4 different bacterial cultures were followed by spectrofluorometry for 17 hours. The fluorescence observed in the graphs below has been normalized with the Optical Density (OD).

● Top10 E.coli 1 and 2

As a reminder, in this case the top10 E.coli was transformed with plasmids containing the pARA part I13453 either optimized with the consensus sequence of CRP (AAATGTGATCTAGATCACATT) (“2”), and non optimized (“1”).

Figure 19: CFP Fluorescence normalized with OD for E.coli T10 transformed with the part 1 and 2 in the absence of any sugar (◇), in the presence of 0.2% arabinose (△) , 0,1% arabinose (☐), 0,05 % arabinose (+), 0.02% arabinose (○) and M9 rich medium (x)

Both strains express CFP, but we observe no difference between the optimised pARA part CFP (2) and the non optimised part (1). We can conclude that the optimisation by the consensus sequence of CRP (AAATGTGATCTAGATCACATT) does not seem to have significant effect on the activity of the pARA I13453.

Summary

Here we have shown that the consensus sequence of CRP (AAATGTGATCTAGATCACATT) seems to not have changed the level of expression of our different pARA promoters. However, it seems that the M9 rich medium have an impact on the activation level of pARA. We do not have an explanation to why the M9 rich medium seems to enhance the activation of our promoters, an experimental error may be possible.

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal XbaI site found at 16
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal NheI site found at 125
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BamHI site found at 65
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal XbaI site found at 16
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal XbaI site found at 16
  
• 1000
  COMPATIBLE WITH RFC[1000]